Tender Notice for the Executive Engineer, Highway Division, Hafizabad. (Oferta №93786763es)

Registrarse

Compartir:
País: India
Idioma: EN
Número: 93786763
Fecha de publicación: 07-11-2023
Fuente:

Descripción

La información completa sobre la licitación está cerrada.
Para seguir trabajando con el sitio, lea la información a continuación

Acerca de nosotros

Motor de búsqueda líder para licitaciones y compras en Rusia y el mundo

  • La mayor base de datos de licitaciones y fuentes de adquisiciones en Rusia y el mundo
  • Envío diario gratuito según su configuración
  • Información sobre los ganadores de las licitaciones en el formato que necesita
  • Cómoda visualización y carga de información

Elíjanos

Comenzando

Registro en el sitio, después de lo cual las siguientes funciones del sitio estarán disponibles para usted:

  • Suscríbase a listas de correo gratuitas para sus frases clave
  • Ver anuncios de licitación
  • Exportar información resumida en formato Excel
  • Ver parte de la información sobre los ganadores, proveedores y clientes de las licitaciones

Registro

Para utilizar todas las funciones del sitio y ver la información completa, necesita registrar una cuenta comercial

  • Tarifa seleccionada
  • Paga por el acceso de cualquiera de las formas posibles

Acceso completo
Quotations are hereby invited for the following: Research Consumables: qPCR master mix. Scope: - Probe qPCR Master Mix - 500 reactions, Qty: 02. Address: ARC-PHP, off Adam Tas road (Behind Distell), Vredenburg farm/campus, Stellenbosch, Banhoek, 7600. Fuente: ONLINE TENDERS

Quotations are hereby invited for the following: Research Consumables: SDS qPCR Assay - Probes and Primers. Scope: - qPCR Probe: ProFsgq1 - TGAATGCCATAGGTCAGAT with FAM+MGBNFQ, Qty: 1; - qPCR Probe: FSGq - TCTTCTAGGATGGGCTGGT with FAM+MGBNFQ, Qty: 1; - qPCR Probe: FVMGB - ACTCAGCGCCCAGGA with FAM+MGBNFQ, Qty: 1; - Probe: FvIGS - ATAGGGTAGGCGGATCTGACTTGGCG with FAM+TAMRA, Qty: 1; - qPCR Probe: FvPrb3 - TTTGGTCTAGGGTAGGCCG with FAM+MGBNFQ, Qty: 1; - Probe: FbPrb1 - TGGGATGCCCT+AATTTTT+ACGG with HEX + 3IABkFQ, Qty: 1; - Primer: Fsgq1F - GATACCCAAGTAGTCTTTGCAGTAAATG, Qty: 1; - Primer: FSGq1 - GGCTGAACTGGCAACTTGGA, Qty: 1; - Primer: FVF - GCAGGCCATGTTGGTTCTGTA, Qty: 1; - Primer: FvIGSF1 - GGTGGTGCGGAAGGTCT, Qty: 1; -Primer: F63 - GTAAGTGAGATTTAGTCTAGGGTAGGTGAC, Qty: 1; - Primer: FbF2 - AGGTCAGATTTGGTATAGGGTAGGTGAGA, Qty: 1; - Primer: Fsgq1R - TTAATGCCTAGTCCCCTATCAACAT, Qty: 1; - Primer: FSGq2 - CAAAGCTTCATTCAATCCTAATACAATC, Qty: 1; - Primer: FVR: GCACGTAAAGTGAGTCGTCTCATC, Qty: 1; - Primer: FvIGSR3 - GTGAGTCGTCTCATC, Qty: 1; - Primer: R6 - GGGACCACCTACCCTACACCTACT, Qty: 1; - Primer: FbR2 - CGGACCATCCGTCTGGGAATTT, Qty: 1. Address: ARC-PHP, off Adam Tas road (Behind Distell), Vredenburg farm/campus, Stellenbosch, Banhoek, 7600. Fuente: ONLINE TENDERS

Quotations are hereby invited for the following: Research Consumables: SDS qPCR Assay - Probe and Primers. Scope: - DNA Probe: 33P-GGATGGCAACGTACGTGACCCT with 6FAM + IBFQ, Qty: 01; - DNA Primer: 382F-ACCCAACAGACACTGTGCTC, Qty: 02; - DNA Primer: 49R-CAGTTTGTCAGTAATCGGTATTCG, Qty: 02. Address: ARC-PHP, off Adam Tas road (Behind Distell), Vredenburg farm/campus, Stellenbosch, Banhoek, 7600. Fuente: ONLINE TENDERS

Extension of Closing Date: Bids are hereby invited for the following: Establishment of a panel of legal practitioners (attorneys and advocates) to the state for a period of thirty-six (36) months. Province: National. Fuente: ONLINE TENDERS

Addendum: Extension of Closing Date and Amendment to Document: Quotations are hereby invited for the appointment of a service provider to assist the DFFE/MLRF to conduct socio-economic study on hake handline, oysters, and white mussels for a period of 12 months. Scope: The study shall include but not limited to: - Evaluate the economic performance of the hake handline, oysters, and white mussel commercial fishing sectors, including revenue, profitability, and contribution to the local and national economy; - Examine the social implications of the hake handline, oysters, and white mussel commercial fishing sectors, including their role in providing employment, income distribution, and community well-being, particularly among small scale fishers; - Map out the entire value chains for the hake handline, oysters, and white mussel commercial fishing sectors, from harvesting and processing to distribution and consumption, highlighting key stakeholders and interactions. Delivery Address: Foretrust building, Cape Town, 8001. Please confirm the contract number as two were published. Fuente: ONLINE TENDERS

Tender Notic Fuente: PPRA SERVICES PORTAL